rs4928040 chr3:54322726 A>G
- Sequence
gaggtagtcttgcagctttaggaa[A/G]cacctggatgatgacaggagggaa
- ASB in cell types
- 22RV1 (prostate carcinoma) liver
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| 22RV1 (prostate carcinoma) | -4.29 | 2.05 | 2.00 | |||
| liver | 1.12 | 0.15 | 1.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP college completion, hdl cholesterol change with statins, neuroticism, paternal transmission distortion