rs492829 chr12:5200661 T>C
- Sequence
ttaccttgttcttcccagaagcct[T/C]gttcagcaagaggagggaggccga
- ASB in cell types
- foreskin keratinocyte BE2C LNCaP (prostate carcinoma) GM19239 (male B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | 1.34 | n/a | 2.33 | |||
| BE2C | 2.76 | -2.50 | 1.00 | |||
| LNCaP (prostate carcinoma) | 0.20 | 0.91 | 1.17 | |||
| GM19239 (male B-cells lymphoblastoid cell line) | -0.36 | 0.75 | 1.11 | |||
| erythroid progenitors | 2.02 | n/a | 2.50 |
Items per page:
1 – 5 of 5