rs4935752 chr11:120818410 A>C
- Sequence
tacaaaatacaagcgggaagaaag[A/C]tccgttatgacacagatcaatgtc
- ASB in cell types
- HepG2 (hepatoblastoma)
- ASB for transcription factors
- SMAD4_HUMAN NFIL3_HUMAN HLF_HUMAN FOXA2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SMAD4_HUMAN | n/a | 2.99 | 1.50 | n/a | No Hit | |||
| NFIL3_HUMAN | n/a | 3.17 | 2.00 | n/a | n/a | |||
| HLF_HUMAN | -4.74 | 2.76 | 1.50 | n/a | No Hit | |||
| FOXA2_HUMAN | -3.79 | 2.45 | 1.33 | n/a | No Hit |
Items per page:
1 – 4 of 4
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, chronic kidney disease, cognitive response to topiramate treatment, hdl cholesterol, nausea in response to topiramate treatment in healthy volunteers, triglycerides, triglycerides change with statins, urinary albumin-to-creatinine ratio