rs4968373 chr17:59470463 A>G
- Sequence
acaaaattagtcgggcgtggtggc[A/G]tgtgcctgtaatcccagctactcg
- ASB for transcription factors
- ZFX_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ZFX_HUMAN | -1.04 | 1.65 | 2.30 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Brain_Cerebellum, Muscle_Skeletal, Skin_Not_Sun_Exposed_Suprapubic, Testis, Thyroid, Whole_Blood