rs4980027 chr10:79083791 C>A
- Sequence
aggagcccactgggaatgcctgtc[C/A]acctccgtgaaacaggctgagcta
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells lymphoblastoid cell line) | 1.81 | n/a | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP diastolic blood pressure (dbp), paternal transmission distortion, response to anti-tumor necrosis factor treatment of rheumatoid arthritis, systolic blood pressure (sbp), transmission distortion
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Artery_Tibial, Esophagus_Muscularis, Nerve_Tibial, Whole_Blood