rs5009524 chr20:40266247 A>T
- Sequence
cttctacagctgtatagattatcc[A/T]attctgatttttaagtcaaatcac
- ASB in cell types
- GM19238 (female B-cells lymphoblastoid cell lines) GM12878 (female B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM19238 (female B-cells lymphoblastoid cell lines) | -0.96 | 1.29 | 1.00 | |||
| GM12878 (female B-cells lymphoblastoid cell line) | 1.17 | -0.65 | 1.00 |
Items per page:
1 – 2 of 2