rs525476 chr1:9315527 C>T
- Sequence
tcgagtcacatgacggggtgggag[C/T]tgaatgtgaatgtgactcctgagc
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line)
- ASB for transcription factors
- USF2_HUMAN RBM25_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| USF2_HUMAN | -2.83 | 3.08 | 1.00 | n/a | No Hit | |||
| RBM25_HUMAN | 1.80 | 0.43 | 2.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP irritible bowel syndrome, salmonella-induced pyroptosis, schizophrenia, sporadic creutzfeldt-jakob disease, total cholesterol change with statins, triglycerides, triglycerides change with statins