rs5265 chr2:231926359 G>C
- Sequence
gctggctgggctgcagggcgagca[G/C]ggtcccagtgctgcgcggcgccgg
- ASB in cell types
- pancreas heart left ventricle
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| pancreas | -2.04 | 2.37 | 1.00 | |||
| heart left ventricle | -1.75 | 2.26 | 1.00 |
Items per page:
1 – 2 of 2