rs5268 chr2:231925343 C>T
- Sequence
ggcggctcgcgcgcctccgaaggc[C/T]ggctgggcggcgggcggtcccggg
- ASB in cell types
- glioblastoma cells HuCCT1 (intrahepatic cholangiocarcinoma) HeLa (cervical adenocarcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| glioblastoma cells | 1.08 | n/a | 1.50 | |||
| HuCCT1 (intrahepatic cholangiocarcinoma) | 2.82 | -5.34 | 2.00 | |||
| HeLa (cervical adenocarcinoma) | -1.32 | 1.10 | 1.50 |
Items per page:
1 – 3 of 3