rs540761118 chr10:41881448 G>T
- Sequence
aatggaatggaatggaatggaatg[G/T]gatggaattaccccgagtggaatg
- ASB in cell types
- U2OS (osteosarcoma)
- ASB for transcription factors
- HSF1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| HSF1_HUMAN | 1.82 | -4.55 | 2.00 | 2.70 | Discordant |
Items per page:
1 – 1 of 1
Motif analysis
