rs544607706 chr17:36188847 C>T
- Sequence
ggaggcccaggaacaggggggcat[C/T]gtgaatgaggaggacgtgggggcc
- ASB in cell types
- Kasumi-1 (acute myeloblastic leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| Kasumi-1 (acute myeloblastic leukemia) | 1.70 | -1.31 | 1.28 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Brain_Cerebellar_Hemisphere, Breast_Mammary_Tissue, Colon_Transverse, Esophagus_Mucosa, Esophagus_Muscularis, Nerve_Tibial, Skin_Sun_Exposed_Lower_leg, Spleen, Testis