rs547698 chr22:45131964 C>T
- Sequence
tttctacagttccccttgtcctca[C/T]ttccccattcattgcaacaggctt
- ASB in cell types
- MDM(monocyte derived macrophages) macrophages form periferal blood neutrophils from periferal blood CD34+ hematopoietic stem progenitor cells
- ASB for transcription factors
- SPI1_HUMAN RAD21_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | 1.72 | -0.33 | 1.50 | -4.02 | Concordant | |||
| RAD21_HUMAN | 1.74 | -1.30 | 1.50 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
Genetic associations
GTEx eQTL Adipose_Visceral_Omentum, Artery_Tibial, Cells_Cultured_fibroblasts, Muscle_Skeletal, Nerve_Tibial, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Whole_Blood