rs549959638 chr17:50866368 C>G
- Sequence
tcgctccttctgccgcggcgcgcg[C/G]cccgcctctcgttttatggcctcc
- ASB in cell types
- U2OS (osteosarcoma)
- ASB for transcription factors
- SPT5H_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPT5H_HUMAN | -0.46 | 1.34 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1