rs55680315 chr17:65588415 G>A
- Sequence
atgcaggtgatgagaaggtgcata[G/A]ggagaactttgaccttcaaggctg
- ASB in cell types
- 22RV1 (prostate carcinoma) breast tumor xenograft MS-1 (Small cell lung carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| 22RV1 (prostate carcinoma) | 1.63 | -0.83 | 1.38 | |||
| breast tumor xenograft | -0.14 | 2.03 | 1.00 | |||
| MS-1 (Small cell lung carcinoma) | n/a | 2.08 | 1.00 |
Items per page:
1 – 3 of 3