rs55698894 chr8:29723117 A>T
- Sequence
ttccgaaaggaaataaacgtttcc[A/T]ttgttcctgttgcaatattgactt
- ASB in cell types
- breast tumor epidermal keratinocytes
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| breast tumor | 2.67 | n/a | 3.00 | |||
| epidermal keratinocytes | 2.00 | -1.08 | 2.00 |
Items per page:
1 – 2 of 2