rs55731255 chr20:44885402 A>G
- Sequence
aatccccatccagaccacactcct[A/G]gtcctccttattcccacacagccc
- ASB in cell types
- HEK293 (embryonic kidney) GM12878 (female B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.25 | 0.87 | 2.03 | |||
| GM12878 (female B-cells lymphoblastoid cell line) | 1.22 | 0.61 | 1.17 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Cells_EBV-transformed_lymphocytes, Esophagus_Gastroesophageal_Junction, Lung, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Stomach, Thyroid