rs55732478 chr4:89856686 G>C
- Sequence
cctgcctctgtagactccacctct[G/C]ggggcagggcatagccaaacaaaa
- ASB in cell types
- WA01 (H1, human embryonic stem cells)
- ASB for transcription factors
- TIF1B_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TIF1B_HUMAN | 2.23 | -0.49 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Frontal_Cortex_BA9, Breast_Mammary_Tissue, Heart_Atrial_Appendage, Heart_Left_Ventricle, Nerve_Tibial, Pituitary, Prostate, Spleen, Whole_Blood