rs55834800 chr17:78256180 G>T
- Sequence
cacaggcacccattgccactcagc[G/T]gctcctcttcctctttctgtcccc
- ASB in cell types
- MDM(monocyte derived macrophages) K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MDM(monocyte derived macrophages) | 2.54 | n/a | 2.00 | |||
| K562 (myelogenous leukemia) | -0.06 | 0.73 | 1.99 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Nucleus_accumbens_basal_ganglia, Brain_Spinal_cord_cervical_c-1, Breast_Mammary_Tissue, Heart_Left_Ventricle, Lung, Prostate, Spleen, Testis, Thyroid, Whole_Blood