rs56027105 chr1:207499747 A>G
- Sequence
gttatccctgctaggtaaaggtgc[A/G]agatagaagggaagttccaatttg
- ASB in cell types
- OCI-LY3 (diffuse large B-cell lymphoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| OCI-LY3 (diffuse large B-cell lymphoma) | 2.46 | -2.18 | 1.00 |
Items per page:
1 – 1 of 1