rs560616 chr3:16373342 C>T
- Sequence
atccctcctgttacacgtgttcac[C/T]gtattgacctaagccaaccagagg
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) GM12891 (male B- cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells lymphoblastoid cell line) | 0.78 | 0.42 | 1.06 | |||
| GM12891 (male B- cells lymphoblastoid cell line) | -1.85 | 2.15 | 1.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Thyroid