rs56120917 chr2:27380806 G>A
- Sequence
cgccgccgcagagacgcacgggac[G/A]cgtagtccgtgggaagcggccgcg
- ASB in cell types
- HepG2 (hepatoblastoma) K562 (myelogenous leukemia) CD14+ monocytes 22RV1 (prostate carcinoma)
- ASB for transcription factors
- GABP1_HUMAN STAT1_HUMAN CREB1_HUMAN TCF21_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| GABP1_HUMAN | n/a | 2.68 | 2.00 | n/a | n/a | |||
| STAT1_HUMAN | 3.01 | -0.43 | 1.60 | n/a | No Hit | |||
| CREB1_HUMAN | 0.35 | 2.09 | 1.73 | n/a | No Hit | |||
| TCF21_HUMAN | 1.84 | n/a | 2.00 | n/a | n/a | |||
| ANDR_HUMAN | 3.36 | n/a | 2.00 | n/a | No Hit |
Items per page:
1 – 5 of 9
Motif analysis
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Ovary, Pancreas, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Testis, Thyroid, Whole_Blood