rs561318 chr3:16373308 C>T
- Sequence
catctctccctttcccccaccttg[C/T]ctcatttagatccctcctgttaca
- ASB in cell types
- GM19238 (female B-cells lymphoblastoid cell lines)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM19238 (female B-cells lymphoblastoid cell lines) | -0.44 | 1.84 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Thyroid