rs56255754 chr3:150348679 C>T
- Sequence
tggtgactcatgtcaagttgcgtg[C/T]gccaagttaagagagtgctgacac
- ASB in cell types
- HUVEC-C (HUVEC, umbilical vein endothelial cells) TTC-1240 (Rhabdoid tumor of the kidney) EOL-1 (Acute myeloid leukemia) Mel270 (Uveal melanoma)
- ASB for transcription factors
- TF65_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TF65_HUMAN | 0.66 | 2.31 | 1.29 | n/a | No Hit |
Items per page:
1 – 1 of 1