rs56979826 chr19:43087965 A>G
- Sequence
ctctagtggccctgtctgggcata[A/G]cagaaggctcgcactcctgtcttc
- ASB in cell types
- Kelly (neuroblastoma) thyroid gland RH4 (alveolar rhabdomyosarcoma) LUHMES (lund human mesencephalic cells)
- ASB for transcription factors
- RAD21_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| RAD21_HUMAN | 1.43 | -0.47 | 1.33 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Minor_Salivary_Gland, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Whole_Blood