rs5719 chr16:23182613 G>T
- Sequence
gggggcgttgtgaagtcgtggccc[G/T]ctccgggcggtctcaggtgcctgg
- ASB in cell types
- erythroid cells MCF7 (Invasive ductal breast carcinoma) WA09 (embryonic stem cells) transverse colon
- ASB for transcription factors
- CTCF_HUMAN KDM6A_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.41 | 0.63 | 1.28 | 3.57 | Discordant | |||
| KDM6A_HUMAN | 2.87 | n/a | 3.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
Genetic associations
GTEx eQTL Adrenal_Gland, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Frontal_Cortex_BA9, Heart_Left_Ventricle, Muscle_Skeletal, Pancreas, Testis, Thyroid