rs57301804 chr10:70589385 C>A
- Sequence
tgagccaagagtcatgggtccagg[C/A]ggggccatctggttgtcagaaatg
- ASB in cell types
- K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.93 | 0.59 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Brain_Caudate_basal_ganglia, Brain_Hippocampus, Brain_Nucleus_accumbens_basal_ganglia, Brain_Spinal_cord_cervical_c-1, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg