rs5754217 chr22:21585386 G>T
- Sequence
atttcattctgtgacttggggtgt[G/T]gttttgctatccaggatccttaga
- ASB in cell types
- K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.46 | 0.35 | 5.76 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, anti-dsdna autoantibody status in systemic lupus erythematosus (sle) patients, aortic valve calcium, body mass index (bmi), celiac disease, crohns disease, hdl cholesterol, height, hip bone mineral density (bmd), irritible bowel syndrome, mean corpuscular volume (mcv), rheumatoid arthritis, rheumatoid arthritis and celiac disease, spine bone mineral density (bmd), sporadic creutzfeldt-jakob disease, systemic lupus erythematosus (sle), systemic lupus erythematosus (sle) (females), total cholesterol, triglycerides, ulcerative colitis
PheWAS abdominal hernia, abnormal papanicolaou smear of cervix and cervical hpv, adverse drug events and drug allergies, adverse effects of adrenal cortical steroids, aseptic necrosis of bone, benign neoplasm of uterus, calculus of lower urinary tract, chronic pancreatitis, concussion, congenital musculoskeletal anomalies, diabetic retinopathy, disorders of diaphragm, disorders of parathyroid gland, disorders of penis, diverticulitis, esophageal bleeding, esophageal cancer, glossitis, gouty arthropathy, history of diseases of digestive system, idiopathic fibrosing alveolitis, inflammatory bowel disease, insomnia, intestinal malabsorption nos, late effects of cerebrovascular disease, mechanical complication of nervous system device, implant, and graft, muscle weakness, obstructive sleep apnea, osteoarthrosis, localized, secondary, other alveolar and parietoalveolar pneumonopathy, other derangement of joint, other hypertrophic and atrophic conditions of skin, other nonmalignant breast conditions, other paralytic syndromes, other symptoms referable to back, periostitis, peripheral or central vertigo, phosphorus metabolism disorder, poisoning by hormones and synthetic substitutes, poisoning by other anti-infectives, posttraumatic wound infection, primary pulmonary hypertension, redundant prepuce and phimosis/bxo, respiratory abnormalities, sacroiliitis nec, sarcoidosis, scleritis and episcleritis, skin neoplasm of uncertain behavior, speech and language disorder, stricture/obstruction of ureter, subarachnoid hemorrhage, sulfonamides, tobacco use disorder, ulcerative colitis, unspecified polyarthropathy or polyarthritis, urethritis and urethral syndrome, uterine leiomyoma, ventral hernia
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Coronary, Artery_Tibial, Brain_Anterior_cingulate_cortex_BA24, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Frontal_Cortex_BA9, Brain_Hippocampus, Brain_Nucleus_accumbens_basal_ganglia, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Minor_Salivary_Gland, Muscle_Skeletal, Nerve_Tibial, Ovary, Pancreas, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Small_Intestine_Terminal_Ileum, Spleen, Stomach, Testis, Thyroid, Uterus, Vagina, Whole_Blood