rs5756982 chr22:38230550 G>T
- Sequence
cagcttcggggggtgggtgctggg[G/T]gcctggggtgcctcataggaaagg
- ASB in cell types
- LNCaP (prostate carcinoma) GM10847 (female B-cells Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| LNCaP (prostate carcinoma) | -0.36 | 1.73 | 1.00 | |||
| GM10847 (female B-cells Lymphoblastoid Cell Lines) | 1.67 | -0.42 | 1.00 |
Items per page:
1 – 2 of 2