rs5757168 chr22:22168470 G>A
- Sequence
tttctatccacactggatgcaaca[G/A]aagtctggccaactttttgagaca
- ASB in cell types
- K562 (myelogenous leukemia) GM12878 (female B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.80 | 0.88 | 5.33 | |||
| GM12878 (female B-cells lymphoblastoid cell line) | 0.87 | 0.91 | 1.12 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, hdl cholesterol, hdl cholesterol change with statins, mitral annular calcium, refractive error, triglycerides
GTEx eQTL Adipose_Visceral_Omentum, Breast_Mammary_Tissue, Cells_EBV-transformed_lymphocytes, Colon_Transverse, Esophagus_Mucosa, Liver, Lung, Minor_Salivary_Gland, Small_Intestine_Terminal_Ileum, Spleen, Stomach, Testis, Thyroid, Whole_Blood