rs5759435 chr22:22748430 G>A
- Sequence
aatttactccttgattctggactc[G/A]tggatcctgactgtgggagaaaca
- ASB in cell types
- GM10847 (female B-cells Lymphoblastoid Cell Lines) LNCaP (prostate carcinoma) Peyer's patch GM19099 (female B-cells Lymphoblastoid Cell Lines)
- ASB for transcription factors
- CTCF_HUMAN STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.84 | -0.47 | 1.63 | n/a | No Hit | |||
| STAG1_HUMAN | 1.71 | 1.21 | 1.75 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Visceral_Omentum, Brain_Spinal_cord_cervical_c-1, Colon_Transverse, Esophagus_Mucosa, Lung, Minor_Salivary_Gland, Small_Intestine_Terminal_Ileum, Spleen, Stomach, Thyroid, Whole_Blood