rs5760629 chr22:24769034 C>A
- Sequence
ttaggttaataaaaacgaggccaa[C/A]tatacagtcctccttgggtatcca
- ASB in cell types
- GM19193 (female B-cells Lymphoblastoid Cell Lines) GM18951 (B-cells Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM19193 (female B-cells Lymphoblastoid Cell Lines) | 1.64 | -2.98 | 1.33 | |||
| GM18951 (B-cells Lymphoblastoid Cell Lines) | -0.77 | 1.29 | 1.00 |
Items per page:
1 – 2 of 2