rs5760630 chr22:24769080 A>C
- Sequence
ccacagggattggttccacagtct[A/C]ccgctgataccaaaatctgtggat
- ASB in cell types
- GM19193 (female B-cells Lymphoblastoid Cell Lines) GM18951 (B-cells Lymphoblastoid Cell Lines) pancreas
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM19193 (female B-cells Lymphoblastoid Cell Lines) | 1.62 | -2.71 | 1.33 | |||
| GM18951 (B-cells Lymphoblastoid Cell Lines) | -0.53 | 1.22 | 1.00 | |||
| pancreas | 0.85 | -0.65 | 1.00 |
Items per page:
1 – 3 of 3