rs5763779 chr22:30108663 A>G
- Sequence
ctgcttcttcatagcaatgaacac[A/G]atgttaatgatgtagctatctttg
- ASB in cell types
- HEK293 (embryonic kidney) EOL-1 (Acute myeloid leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.65 | -0.04 | 1.96 | |||
| EOL-1 (Acute myeloid leukemia) | 2.21 | -1.89 | 1.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP college completion, coronary artery disease (cad), hdl cholesterol, homa-b, infant head circumference, irritible bowel syndrome, total cholesterol change with statins, type 1 diabetes, years of education
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Putamen_basal_ganglia, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Lung, Muscle_Skeletal, Nerve_Tibial, Ovary, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Testis, Thyroid, Uterus, Vagina, Whole_Blood