rs5764807 chr22:45605563 A>T
- Sequence
aattattaaacatcatgaggcatt[A/T]ggaggcttgggcacgcactgataa
- ASB in cell types
- HKC8 (kidney proximal tubule cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HKC8 (kidney proximal tubule cell line) | 0.46 | 1.06 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Coronary, Artery_Tibial, Brain_Cerebellum, Breast_Mammary_Tissue, Colon_Sigmoid, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Heart_Atrial_Appendage, Lung, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg