rs5765167 chr22:45101857 T>C
- Sequence
catttcgtaaatgggctgggggtg[T/C]gccagaaccatcgccggggaccca
- ASB in cell types
- GM12892 (female B-cells lymphoblastoid cell line) epithelial cell of prostate GM02255 (Lymphoblastoid Cell Lines) GM18951 (B-cells Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12892 (female B-cells lymphoblastoid cell line) | -2.87 | 2.01 | 1.33 | |||
| epithelial cell of prostate | -2.14 | 2.54 | 1.00 | |||
| GM02255 (Lymphoblastoid Cell Lines) | 1.43 | -1.66 | 1.33 | |||
| GM18951 (B-cells Lymphoblastoid Cell Lines) | 1.65 | -1.38 | 1.00 |
Items per page:
1 – 4 of 4