rs5765911 chr22:44697779 G>A
- Sequence
tgctgactctgacctcggacatac[G/A]cctcggcctccctgggcctctgtt
- ASB in cell types
- Peyer's patch GM02630 (Fanconi anemi)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| Peyer's patch | -0.55 | 1.29 | 1.00 | |||
| GM02630 (Fanconi anemi) | 0.61 | -0.53 | 1.00 |
Items per page:
1 – 2 of 2