rs5766706 chr22:47165824 A>G
- Sequence
catcagggcctccccactgcagac[A/G]gctggcactccacagcacctgctg
- ASB in cell types
- TMD8 (diffuse large B-cell lymphoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| TMD8 (diffuse large B-cell lymphoma) | -4.65 | 2.55 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP body mass index (bmi), hypertension (early onset hypertension), ldl cholesterol change with statins, obesity (body mass index (bmi)), total cholesterol change with statins