rs5769010 chr22:46596937 T>C
- Sequence
gagacctccactcctttgcagagc[T/C]tggatggctgcagggctggcttag
- ASB in cell types
- Peyer's patch 22RV1 (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| Peyer's patch | 1.34 | -0.32 | 1.00 | |||
| 22RV1 (prostate carcinoma) | -1.09 | 2.12 | 2.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), college completion, hip bone mineral density (bmd), rheumatoid arthritis, serum creatinine, spine bone mineral density (bmd)
GTEx eQTL Esophagus_Mucosa, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Whole_Blood