rs5770226 chr22:49305111 A>G
- Sequence
gtgcctccaggccctgtttgcaga[A/G]gacagcaggacctggggagggcct
- ASB in cell types
- MS-1 (Small cell lung carcinoma) GM12878 (female B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MS-1 (Small cell lung carcinoma) | -2.57 | 2.79 | 1.00 | |||
| GM12878 (female B-cells lymphoblastoid cell line) | 1.32 | -2.51 | 1.28 |
Items per page:
1 – 2 of 2