rs5771917 chr22:48663499 T>G
- Sequence
agcatgattttacccagctgactc[T/G]gtctctatcaccacctggtggcag
- ASB in cell types
- IPSC-derived bipolar neuron MS-1 (Small cell lung carcinoma) foreskin keratinocyte PC9 (lung adenocarcinoma)
- ASB for transcription factors
- STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAG1_HUMAN | -1.26 | 1.95 | 1.25 | n/a | n/a |
Items per page:
1 – 1 of 1