rs57915176 chr2:20450086 A>G
- Sequence
ttattctaagttcagagaagggcc[A/G]tattgtggaaagaacattggatgt
- ASB in cell types
- HeLa S3 (cervical adenocarcinoma)
- ASB for transcription factors
- MK03_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| MK03_HUMAN | 2.05 | -1.38 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1