rs58350456 chr19:29760330 G>A
- Sequence
gcggggctgtcccgctccgagagc[G/A]gcgggaagcgccagccaggccggc
- ASB in cell types
- erythroid cells foreskin keratinocyte GM19238 (female B-cells lymphoblastoid cell lines)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| erythroid cells | n/a | 3.70 | 2.00 | |||
| foreskin keratinocyte | 0.86 | n/a | 2.50 | |||
| GM19238 (female B-cells lymphoblastoid cell lines) | -1.09 | 1.24 | 1.44 |
Items per page:
1 – 3 of 3