rs583912 chr22:20195516 G>C
- Sequence
gagctccccctgcccgtgagccct[G/C]cttgcacttcctcacccgtcctca
- ASB in cell types
- MOLM-13(acute monocytic leukemia(AML), Homo sapiens)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MOLM-13(acute monocytic leukemia(AML), Homo sapiens) | 2.74 | -2.62 | 1.00 |
Items per page:
1 – 1 of 1