rs58442437 chr7:108030657 G>A
- Sequence
ttctacagatagaaaatcctttgt[G/A]catcaggatcccctcaaagatata
- ASB in cell types
- TTC-1240 (Rhabdoid tumor of the kidney)
- ASB for transcription factors
- SMCA4_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SMCA4_HUMAN | -0.86 | 1.50 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1