rs58458111 chr16:87782728 G>A
- Sequence
tcacaggtgtgagccaccgcgccc[G/A]gccttgtactttcgttttcaataa
- ASB in cell types
- U937 (adult acute monocytic leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| U937 (adult acute monocytic leukemia) | -1.51 | 2.55 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Cells_Cultured_fibroblasts, Esophagus_Muscularis, Heart_Atrial_Appendage, Nerve_Tibial, Skin_Sun_Exposed_Lower_leg