rs585189 chr15:57767905 T>C
- Sequence
aggcagggggctcaggtgttctca[T/C]agataagaaatggatatctgagtt
- ASB in cell types
- MOLT-4 (Adult T acute lymphoblastic leukemia)
- ASB for transcription factors
- CDK9_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CDK9_HUMAN | -1.32 | 2.51 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP coronary artery disease (cad), hdl cholesterol change with statins, total cholesterol, triglycerides change with statins