rs58526131 chr9:39016381 T>G
- Sequence
tgtgtgcacctacttatgaactca[T/G]tattctgttctcttgacctatttt
- ASB in cell types
- HepG2 (hepatoblastoma) GM12878 (female B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HepG2 (hepatoblastoma) | 2.09 | -1.05 | 1.29 | |||
| GM12878 (female B-cells lymphoblastoid cell line) | 1.73 | -0.91 | 1.44 |
Items per page:
1 – 2 of 2