rs58667 chr22:45272131 C>T
- Sequence
taggaactagcagccaaaggacaa[C/T]gtcagaaatgaccgagtcaggagt
- ASB in cell types
- renal cortex sigmoid colon
- ASB for transcription factors
- CREB1_HUMAN EP300_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CREB1_HUMAN | 2.58 | -2.24 | 1.00 | n/a | No Hit | |||
| EP300_HUMAN | 2.00 | 0.17 | 1.11 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP abnormal involuntary movement scale, birth weight, hdl cholesterol, lung function, forced expiratory volume in 1 second (fev1) percent predicted (in asthmatic participants), lung function, forced vital capacity (fvc) (fev1/fvc) percent predicted (in asthmatic participants), lung function, ratio of forced expiratory volume in 1 second (fev1) to forced vital capacity (fvc) (fev1/fvc) (in asthmatic participants), microalbuminuria, mitral annular calcium, total cholesterol