rs587274 chr18:63994976 C>A
- Sequence
agcagggaggcaaagatgactatc[C/A]ggcgccctctactggacgatctag
- ASB in cell types
- GM18505 (female B-cells Lymphoblastoid Cell Lines) WA09 (embryonic stem cells) neural cell
- ASB for transcription factors
- STAG1_HUMAN RAD21_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAG1_HUMAN | 1.29 | -0.93 | 1.08 | n/a | n/a | |||
| RAD21_HUMAN | 0.94 | -0.01 | 1.15 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, paternal transmission distortion, transmission distortion, years of education