rs5905126 chrX:147740072 T>G
- Sequence
agaaaaactgtgtccaccagtagg[T/G]ggcttgattacctagagaagcaga
- ASB in cell types
- GM12890 (Lymphoblastoid Cell Lines)
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | -1.13 | 2.12 | 2.00 | 0.46 | Weak Concordant |
Items per page:
1 – 1 of 1
Motif analysis
